Enzymes with Multiple Recognition Sequences

Example:

AccI recognizes each of the following sequences:
GTAGAC or GTATAC or GTCGAC or GTCTAC

Single Letter Code

Enzyme Recognition Sequence
AatII GACGT/C
AbaSI CNNNNNNNNNNN/NNNNNNNNNG
Acc65I G/GTACC
AccI GT/MKAC
AciI CCGC(-3/-1)
AclI AA/CGTT
AcuI CTGAAG(16/14)
AfeI AGC/GCT
AflII C/TTAAG
AflIII A/CRYGT
AgeI § A/CCGGT
AgeI-HF® A/CCGGT
AhdI GACNNN/NNGTC
AleI-v2 CACNN/NNGTG
AluI AG/CT
AlwI GGATC(4/5)
AlwNI CAGNNN/CTG
ApaI GGGCC/C
ApaLI G/TGCAC
ApeKI G/CWGC
ApoI § R/AATTY
ApoI-HF R/AATTY
AscI GG/CGCGCC
AseI AT/TAAT
AsiSI GCGAT/CGC
AvaI C/YCGRG
AvaII G/GWCC
AvrII C/CTAGG
BaeGI GKGCM/C
BaeI (10/15)ACNNNNGTAYC(12/7)
BamHI § G/GATCC
BamHI-HF® G/GATCC
BanI G/GYRCC
BanII GRGCY/C
BbsI § GAAGAC(2/6)
BbsI-HF® GAAGAC(2/6)
BbvCI CCTCAGC(-5/-2)
BbvI GCAGC(8/12)
BccI CCATC(4/5)
BceAI ACGGC(12/14)
BcgI (10/12)CGANNNNNNTGC(12/10)
BciVI GTATCC(6/5)
BclI § T/GATCA
BclI-HF T/GATCA
BcoDI GTCTC(1/5)
BfaI C/TAG
BfuAI ACCTGC(4/8)
BglI GCCNNNN/NGGC
BglII A/GATCT
BlpI GC/TNAGC
BmgBI CACGTC(-3/-3)
BmrI ACTGGG(5/4)
BmtI § GCTAG/C
BmtI-HF® GCTAG/C
BpmI CTGGAG(16/14)
BpuEI CTTGAG(16/14)
Bpu10I CCTNAGC(-5/-2)
BsaAI YAC/GTR
BsaBI GATNN/NNATC
BsaHI GR/CGYC
BsaI § GGTCTC(1/5)
BsaI-HF®v2 GGTCTC(1/5)
BsaJI C/CNNGG
BsaWI W/CCGGW
BsaXI (9/12)ACNNNNNCTCC(10/7)
BseRI GAGGAG(10/8)
BseYI CCCAGC(-5/-1)
BsgI GTGCAG(16/14)
BsiEI CGRY/CG
BsiHKAI GWGCW/C
BsiWI § C/GTACG
BsiWI-HF® C/GTACG
BslI CCNNNNN/NNGG
BsmAI GTCTC(1/5)
BsmBI CGTCTC(1/5)
BsmFI GGGAC(10/14)
BsmI GAATGC(1/-1)
BsoBI C/YCGRG
BspCNI CTCAG(9/7)
BspDI AT/CGAT
BspEI T/CCGGA
BspHI T/CATGA
Bsp1286I GDGCH/C
BspMI ACCTGC(4/8)
BspQI GCTCTTC(1/4)
BsrBI CCGCTC(-3/-3)
BsrDI GCAATG(2/0)
BsrFI-v2 R/CCGGY
BsrGI § T/GTACA
BsrGI-HF® T/GTACA
BsrI ACTGG(1/-1)
BssHII G/CGCGC
BssSI-v2 CACGAG(-5/-1)
BstAPI GCANNNN/NTGC
BstBI TT/CGAA
BstEII  § G/GTNACC
BstEII-HF® G/GTNACC
BstNI CC/WGG
BstUI CG/CG
BstXI CCANNNNN/NTGG
BstYI R/GATCY
BstZ17I-HF® GTATAC
Bsu36I CC/TNAGG
BtgI C/CRYGG
BtgZI GCGATG(10/14)
BtsCI GGATG(2/0)
BtsIMutI CAGTG(2/0)
BtsI-v2 GCAGTG(2/0)
Cac8I GCN/NGC
ClaI AT/CGAT
CspCI (11/13)CAANNNNNGTGG(12/10)
CviAII C/ATG
CviKI-1 RG/CY
CviQI G/TAC
DdeI C/TNAG
DpnI GA/TC
DpnII /GATC
DraI TTT/AAA
DraIII-HF® CACNNN/GTG
DrdI GACNNNN/NNGTC
EaeI Y/GGCCR
EagI § C/GGCCG
EagI-HF® C/GGCCG
EarI CTCTTC(1/4)
EciI GGCGGA(11/9)
Eco53kI GAG/CTC
EcoNI CCTNN/NNNAGG
EcoO109I RG/GNCCY
EcoP15I CAGCAG(25/27)
EcoRI § G/AATTC
EcoRI-HF® G/AATTC
EcoRV § GAT/ATC
EcoRV-HF® GAT/ATC
Esp3I CGTCTC(1/5)
FatI /CATG
FauI CCCGC(4/6)
Fnu4HI GC/NGC
FokI GGATG(9/13)
FseI GGCCGG/CC
FspEI CC(12/16)
FspI TGC/GCA
HaeII RGCGC/Y
HaeIII GG/CC
HgaI GACGC(5/10)
HhaI GCG/C
HincII GTY/RAC
HindIII § A/AGCTT
HindIII-HF® A/AGCTT
HinfI G/ANTC
HinP1I G/CGC
HpaI GTT/AAC
HpaII C/CGG
HphI GGTGA(8/7)
HpyAV CCTTC(6/5)
HpyCH4III ACN/GT
HpyCH4IV A/CGT
HpyCH4V TG/CA
Hpy188I TCN/GA
Hpy99I CGWCG/
Hpy166II GTN/NAC
Hpy188III TC/NNGA
I-CeuI TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)
I-SceI TAGGGATAACAGGGTAAT(-9/-13)
KasI G/GCGCC
KpnI § GGTAC/C
KpnI-HF® GGTAC/C
LpnPI CCDG(10/14)
MboI /GATC
MboII GAAGA(8/7)
MfeI § C/AATTG
MfeI-HF® C/AATTG
MluCI /AATT
MluI § A/CGCGT
MluI-HF® A/CGCGT
MlyI GAGTC(5/5)
MmeI TCCRAC(20/18)
MnlI CCTC(7/6)
MscI TGG/CCA
MseI T/TAA
MslI CAYNN/NNRTG
MspA1I CMG/CKG
MspI C/CGG
MspJI CNNR(9/13)
MwoI GCNNNNN/NNGC
NaeI GCC/GGC
NarI GG/CGCC
Nb.BbvCI CCTCAGC
Nb.BsmI GAATGC
Nb.BsrDI GCAATG
Nb.BssSI CACGAG
Nb.BtsI GCAGTG
NciI CC/SGG
NcoI § C/CATGG
NcoI-HF® C/CATGG
NdeI CA/TATG
NgoMIV G/CCGGC
NheI § G/CTAGC
NheI-HF® G/CTAGC
NlaIII CATG/
NlaIV GGN/NCC
NmeAIII GCCGAG(21/19)
NotI § GC/GGCCGC
NotI-HF® GC/GGCCGC
NruI § TCG/CGA
NruI-HF® TCG/CGA
NsiI § ATGCA/T
NsiI-HF® ATGCA/T
NspI RCATG/Y
Nt.AlwI GGATC(4/-5)
Nt.BbvCI CCTCAGC(-5/-7)
Nt.BsmAI GTCTC(1/-5)
Nt.BspQI GCTCTTC(1/-7)
Nt.BstNBI GAGTC(4/-5)
Nt.CviPII (0/-1)CCD
PacI TTAAT/TAA
PaeR7I C/TCGAG
PciI A/CATGT
PflFI GACN/NNGTC
PflMI CCANNNN/NTGG
PI-PspI TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17)
PI-SceI ATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19)
PleI GAGTC(4/5)
PluTI GGCGC/C
PmeI GTTT/AAAC
PmlI CAC/GTG
PpuMI RG/GWCCY
PshAI GACNN/NNGTC
PsiI-v2 TTA/TAA
PspGI /CCWGG
PspOMI G/GGCCC
PspXI VC/TCGAGB
PstI § CTGCA/G
PstI-HF® CTGCA/G
PvuI § CGAT/CG
PvuI-HF® CGAT/CG
PvuII § CAG/CTG
PvuII-HF® CAG/CTG
RsaI GT/AC
RsrII CG/GWCCG
SacI § GAGCT/C
SacI-HF® GAGCT/C
SacII CCGC/GG
SalI § G/TCGAC
SalI-HF® G/TCGAC
SapI GCTCTTC(1/4)
Sau3AI /GATC
Sau96I G/GNCC
SbfI § CCTGCA/GG
SbfI-HF® CCTGCA/GG
ScaI-HF® AGT/ACT
ScrFI CC/NGG
SexAI A/CCWGGT
SfaNI GCATC(5/9)
SfcI C/TRYAG
SfiI GGCCNNNN/NGGCC
SfoI GGC/GCC
SgrAI CR/CCGGYG
SmaI CCC/GGG
SmlI C/TYRAG
SnaBI TAC/GTA
SpeI § A/CTAGT
SpeI-HF® A/CTAGT
SphI § GCATG/C
SphI-HF® GCATG/C
SrfI GCCC/GGGC
SspI § AAT/ATT
SspI-HF® AAT/ATT
StuI AGG/CCT
StyD4I /CCNGG
StyI § C/CWWGG
StyI-HF® C/CWWGG
SwaI ATTT/AAAT
TaqI-v2 T/CGA
TfiI G/AWTC
TseI G/CWGC
Tsp45I /GTSAC
TspMI C/CCGGG
TspRI NNCASTGNN/
Tth111I GACN/NNGTC
XbaI T/CTAGA
XcmI CCANNNNN/NNNNTGG
XhoI C/TCGAG
XmaI C/CCGGG
XmnI GAANN/NNTTC
ZraI GAC/GTC

§ An HF version of this enzyme is available.